Growth Characteristic and the Study of Polymorphism Growth Hormone Genes of Sentul Chicken

نویسندگان

چکیده

The research was conducted to study the characteristics of growth, carcass production and growth hormone gene polymorphisms in various male sentul chickens. using experimental methods with a completely randomized design. material 100 day old chickens Sentul. treatment fixed factor, namely variation color feathers Sentul consisting of: “Abu” Sentul, “Emas” “Geni” “Debu” “Batu” Sentul.. Each unit consisted 5 4 replications. variables measured included: hatching weight, body weight gain percentage produced at age 8 weeks. Identification used primary design Gallus gallus haplotype GH-h22 (GH) gene, complete cds, GenBank: JN675393.1 forward primer / Sequence: AGGTGGTTCGGTTTTCACTG reverse TCCCTTCTTCCAGGTCCTTT. Characteristics data were analyzed by analysis variance; while determine presence GH bioedit program. Analysis variance showed that there no significant differences (P> 0.05) between results sequencing base length 80 bp mutation from adinine cytosine, when comparing GenBank. present monomorphic homozygous genotypes CC. this can be concluded are relatively same, as well gene.
 Keywords: chickens, percentage, monomorphic.

برای دانلود رایگان متن کامل این مقاله و بیش از 32 میلیون مقاله دیگر ابتدا ثبت نام کنید

اگر عضو سایت هستید لطفا وارد حساب کاربری خود شوید

منابع مشابه

an investigation about the relationship between insurance lines and economic growth; the case study of iran

مطالعات قبلی بازار بیمه را به صورت کلی در نظر می گرفتند اما در این مطالعه صنعت بیمه به عنوان متغیر مستفل به بیمه های زندگی و غیر زندگی شکسته شده و هم چنین بیمه های زندگی به رشته های مختلف بیمه ای که در بازار بیمه ایران سهم قابل توجهی دارند تقسیم میشود. با استفاده از روشهای اقتصاد سنجی داده های برای دوره های 48-89 از مراکز ملی داده جمع آوری شد سپس با تخمین مدل خود بازگشتی برداری همراه با تعدادی ...

15 صفحه اول

The Influence of Growth Hormone Gene Polymorphism on Growth Rate of Young Cattle

Beef production is an important development area in animal breeding with meat quality being determined by both paratypic and genetic factors. In this regard evaluating genetic material for the presence of desirable allele combinations of genes associated with growth and development indicators, as well as meat qualities of animals have a certain scientific and practical significance. The aim of ...

متن کامل

the study of aaag repeat polymorphism in promoter of errg gene and its association with the risk of breast cancer in isfahan region

چکیده: سرطان پستان دومین عامل مرگ مرتبط با سرطان در خانم ها است. از آنجا که سرطان پستان یک تومور وابسته به هورمون است، می تواند توسط وضعیت هورمون های استروئیدی شامل استروژن و پروژسترون تنظیم شود. استروژن نقش مهمی در توسعه و پیشرفت سرطان پستان ایفا می کند و تاثیر خود را روی بیان ژن های هدف از طریق گیرنده های استروژن اعمال می کند. اما گروه دیگری از گیرنده های هسته ای به نام گیرنده های مرتبط به ا...

15 صفحه اول

wuthering heights and the concept of marality/a sociological study of the novel

to discuss my point, i have collected quite a number of articles, anthologies, and books about "wuthering heights" applying various ideas and theories to this fantastic story. hence, i have come to believe that gadamer and jauss are rightful when they claim that "the individaul human mind is the center and origin of all meaning," 3 that reading literature is a reader-oriented activity, that it ...

15 صفحه اول

a case study of the two translators of the holy quran: tahereh saffarzadeh and laleh bakhtiar

بطورکلی، کتاب های مقدسی همچون قران کریم را خوانندگان میتوان مطابق با پیش زمینه های مختلفی که درند درک کنند. محقق تلاش کرده نقش پیش زمینه اجتماعی-فرهنگی را روی ایدئولوژی های مترجمین زن و در نتیجه تاثیراتش را روی خواندن و ترجمه آیات قرآن کریم بررسی کند و ببیند که آیا تفاوت های واژگانی عمده ای میان این مترجمین وجود دارد یا نه. به این منظور، ترجمه 24 آیه از آیات قرآن کریم مورد بررسی مقایسه ای قرار ...

15 صفحه اول

ذخیره در منابع من


  با ذخیره ی این منبع در منابع من، دسترسی به آن را برای استفاده های بعدی آسان تر کنید

ژورنال

عنوان ژورنال: KnE Life Sciences

سال: 2022

ISSN: ['2413-0877']

DOI: https://doi.org/10.18502/kls.v0i0.11834